Transcript: Human XM_017025203.1

PREDICTED: Homo sapiens BRCA1 interacting protein C-terminal helicase 1 (BRIP1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRIP1 (83990)
Length:
4034
CDS:
109..2004

Additional Resources:

NCBI RefSeq record:
XM_017025203.1
NBCI Gene record:
BRIP1 (83990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368638 ATAACCCAAGTCGCTATATAT pLKO_005 806 CDS 100% 15.000 21.000 N BRIP1 n/a
2 TRCN0000049914 CGTCAGAACTTGGTGTTACAT pLKO.1 19 5UTR 100% 5.625 4.500 N BRIP1 n/a
3 TRCN0000358703 CTCAATCAGAAACCATTATTT pLKO_005 1457 CDS 100% 15.000 10.500 N BRIP1 n/a
4 TRCN0000049915 GCTCTTATTCTAGTGGATGAT pLKO.1 775 CDS 100% 4.950 3.465 N BRIP1 n/a
5 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2243 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09143 pDONR223 100% 49.2% 48.5% None (many diffs) n/a
2 ccsbBroad304_09143 pLX_304 0% 49.2% 48.5% V5 (many diffs) n/a
3 TRCN0000477014 AAGGTTTATCCCAAGTATCTGTGT pLX_317 12.2% 49.2% 48.5% V5 (many diffs) n/a
Download CSV