Transcript: Human XM_017025527.1

PREDICTED: Homo sapiens CD226 molecule (CD226), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD226 (10666)
Length:
5579
CDS:
948..1493

Additional Resources:

NCBI RefSeq record:
XM_017025527.1
NBCI Gene record:
CD226 (10666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416820 GTACTCATGCATGGATCTTTA pLKO_005 1533 3UTR 100% 13.200 18.480 N CD226 n/a
2 TRCN0000057636 CGCAGACCAAAGACTAGAGTT pLKO.1 1470 CDS 100% 4.950 3.960 N CD226 n/a
3 TRCN0000434449 ATGATACAAGAGAGGATATTT pLKO_005 1426 CDS 100% 15.000 10.500 N CD226 n/a
4 TRCN0000421790 GCTTTGGGCAAGGGCTATTTA pLKO_005 1746 3UTR 100% 15.000 10.500 N CD226 n/a
5 TRCN0000057635 CCCAAGACAAATAGTGAGCAA pLKO.1 1055 CDS 100% 2.640 1.848 N CD226 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07666 pDONR223 100% 53.7% 53.5% None 0_1ins465;454A>G n/a
2 ccsbBroad304_07666 pLX_304 0% 53.7% 53.5% V5 0_1ins465;454A>G n/a
3 TRCN0000480825 TGTTGGCTCTCGCACATGCACCCA pLX_317 33.2% 53.7% 53.5% V5 0_1ins465;454A>G n/a
Download CSV