Transcript: Human XM_017025529.2

PREDICTED: Homo sapiens RAB31, member RAS oncogene family (RAB31), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB31 (11031)
Length:
4143
CDS:
183..917

Additional Resources:

NCBI RefSeq record:
XM_017025529.2
NBCI Gene record:
RAB31 (11031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047734 GCAGCTGTTATCGTGTATGAT pLKO.1 570 CDS 100% 5.625 4.500 N RAB31 n/a
2 TRCN0000286596 GCAGCTGTTATCGTGTATGAT pLKO_005 570 CDS 100% 5.625 4.500 N RAB31 n/a
3 TRCN0000047733 CGTGGTTGAGACAAGTGCAAA pLKO.1 761 CDS 100% 4.950 3.960 N RAB31 n/a
4 TRCN0000100437 CCAGGATCACTTTGACCACAA pLKO.1 410 CDS 100% 4.050 3.240 N Rab31 n/a
5 TRCN0000324913 CCAGGATCACTTTGACCACAA pLKO_005 410 CDS 100% 4.050 3.240 N Rab31 n/a
6 TRCN0000381101 AGTGCGACCTCTCAGATATTA pLKO_005 688 CDS 100% 15.000 10.500 N RAB31 n/a
7 TRCN0000294018 TTATGTGTATGGGATTCTAAA pLKO_005 1240 3UTR 100% 13.200 9.240 N RAB31 n/a
8 TRCN0000294019 CATTGGCTCCCATGTACTATC pLKO_005 538 CDS 100% 10.800 7.560 N RAB31 n/a
9 TRCN0000380851 TCCTGTGCTACCTATCCAAAT pLKO_005 1280 3UTR 100% 10.800 7.560 N RAB31 n/a
10 TRCN0000379576 TGCTAAGGAATACGCTGAATC pLKO_005 728 CDS 100% 10.800 7.560 N RAB31 n/a
11 TRCN0000047735 CCACAACATCAGCCCTACTAT pLKO.1 425 CDS 100% 5.625 3.938 N RAB31 n/a
12 TRCN0000047736 TGAAAGAACATGGTCCAGAAA pLKO.1 640 CDS 100% 4.950 3.465 N RAB31 n/a
13 TRCN0000381460 TCAAGGAATCAGCCGCCAGAT pLKO_005 809 CDS 100% 4.050 2.835 N Rab31 n/a
14 TRCN0000047737 CAAAGTTGAGAAGCCAACCAT pLKO.1 872 CDS 100% 3.000 2.100 N RAB31 n/a
15 TRCN0000286660 CAAAGTTGAGAAGCCAACCAT pLKO_005 872 CDS 100% 3.000 2.100 N RAB31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02601 pDONR223 100% 79.9% 72% None 1_37del;76_185del n/a
2 ccsbBroad304_02601 pLX_304 0% 79.9% 72% V5 1_37del;76_185del n/a
3 TRCN0000478294 AAAGATATTTGATCCCACCCCATA pLX_317 59.8% 79.9% 72% V5 1_37del;76_185del n/a
Download CSV