Transcript: Human XM_017025558.1

PREDICTED: Homo sapiens collagen and calcium binding EGF domains 1 (CCBE1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCBE1 (147372)
Length:
2031
CDS:
839..1939

Additional Resources:

NCBI RefSeq record:
XM_017025558.1
NBCI Gene record:
CCBE1 (147372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415424 AGCTGACCTGGGCAAGTATAT pLKO_005 1516 CDS 100% 13.200 10.560 N CCBE1 n/a
2 TRCN0000055473 CCGAGTGCTGTGTACTTGTTA pLKO.1 1159 CDS 100% 5.625 4.500 N CCBE1 n/a
3 TRCN0000055476 GAAGCCATACTGTCTGGATAT pLKO.1 1222 CDS 100% 10.800 7.560 N CCBE1 n/a
4 TRCN0000425393 CCCAGAAGATTACGACGTTTG pLKO_005 1096 CDS 100% 6.000 4.200 N CCBE1 n/a
5 TRCN0000055474 CCATGAGAAGTCTGAGAACAT pLKO.1 1393 CDS 100% 4.950 3.465 N CCBE1 n/a
6 TRCN0000055475 GCTACTTATGCTGGCTGACAT pLKO.1 1922 CDS 100% 4.950 3.465 N CCBE1 n/a
7 TRCN0000055477 GTTCCCTTTACCTCAGGAATT pLKO.1 2009 3UTR 100% 0.000 0.000 N CCBE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025558.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13238 pDONR223 100% 35.3% 35% None 1_573del;988_1057del;1098_1099ins190 n/a
2 ccsbBroad304_13238 pLX_304 0% 35.3% 35% V5 1_573del;988_1057del;1098_1099ins190 n/a
3 TRCN0000468830 GTGTAAAAGATTTGCGCTGATTGG pLX_317 60.9% 35.3% 35% V5 1_573del;988_1057del;1098_1099ins190 n/a
Download CSV