Transcript: Human XM_017025749.1

PREDICTED: Homo sapiens SMAD family member 2 (SMAD2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMAD2 (4087)
Length:
7683
CDS:
228..1019

Additional Resources:

NCBI RefSeq record:
XM_017025749.1
NBCI Gene record:
SMAD2 (4087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040036 CGATTAGATGAGCTTGAGAAA pLKO.1 396 CDS 100% 4.950 6.930 N SMAD2 n/a
2 TRCN0000288651 CGATTAGATGAGCTTGAGAAA pLKO_005 396 CDS 100% 4.950 6.930 N SMAD2 n/a
3 TRCN0000010476 GACGATTAGATGAGCTTGAGA pLKO.1 394 CDS 100% 3.000 2.100 N SMAD2 n/a
4 TRCN0000089025 CCTTACCACTATCAGAGAGTA pLKO.1 717 CDS 100% 4.950 3.465 N Smad3 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3943 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3943 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00961 pDONR223 100% 54.3% 52.2% None (many diffs) n/a
2 ccsbBroad304_00961 pLX_304 0% 54.3% 52.2% V5 (many diffs) n/a
3 TRCN0000465710 TTTCGGTCGAACATAGACGACCGG pLX_317 25.6% 54.3% 52.2% V5 (many diffs) n/a
Download CSV