Transcript: Human XM_017025778.2

PREDICTED: Homo sapiens myelin basic protein (MBP), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBP (4155)
Length:
4715
CDS:
16..693

Additional Resources:

NCBI RefSeq record:
XM_017025778.2
NBCI Gene record:
MBP (4155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375536 GGGAGGACAACACCTTCAAAG pLKO_005 404 CDS 100% 10.800 7.560 N Mbp n/a
2 TRCN0000090247 ACAGCAAGTACCATGGACCAT pLKO.1 550 CDS 100% 2.640 1.848 N Mbp n/a
3 TRCN0000116261 CCTGGCCACAGCAAGTACCAT pLKO.1 543 CDS 100% 1.000 0.600 N MBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00981 pDONR223 100% 65.9% 67.6% None 1_172del;221_222ins88 n/a
2 ccsbBroad304_00981 pLX_304 0% 65.9% 67.6% V5 1_172del;221_222ins88 n/a
3 TRCN0000481619 TTCGGATGTTAAATAACATACGCA pLX_317 75.9% 65.9% 67.6% V5 1_172del;221_222ins88 n/a
Download CSV