Transcript: Human XM_017025933.1

PREDICTED: Homo sapiens TATA-box binding protein associated factor 4b (TAF4B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF4B (6875)
Length:
3937
CDS:
438..2264

Additional Resources:

NCBI RefSeq record:
XM_017025933.1
NBCI Gene record:
TAF4B (6875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310315 AGCAAGTTAAGGCCCTATTTG pLKO_005 2527 3UTR 100% 13.200 18.480 N TAF4B n/a
2 TRCN0000053150 GCCGAACTCTAGCTCACAATT pLKO.1 161 5UTR 100% 13.200 18.480 N TAF4B n/a
3 TRCN0000290896 GCCGAACTCTAGCTCACAATT pLKO_005 161 5UTR 100% 13.200 18.480 N TAF4B n/a
4 TRCN0000296690 CCGAGACCACAAGTAACATAA pLKO_005 88 5UTR 100% 13.200 9.240 N TAF4B n/a
5 TRCN0000053149 GCACACTCATTCAGTCATGTA pLKO.1 1603 CDS 100% 4.950 3.465 N TAF4B n/a
6 TRCN0000053151 GCAGAAGAATTTACTAGGAAA pLKO.1 573 CDS 100% 4.950 3.465 N TAF4B n/a
7 TRCN0000290827 GCAGAAGAATTTACTAGGAAA pLKO_005 573 CDS 100% 4.950 3.465 N TAF4B n/a
8 TRCN0000053148 GCCCAATCTTAAAGCAGAGAA pLKO.1 383 5UTR 100% 4.950 3.465 N TAF4B n/a
9 TRCN0000290825 GCCCAATCTTAAAGCAGAGAA pLKO_005 383 5UTR 100% 4.950 3.465 N TAF4B n/a
10 TRCN0000053152 GCTGTGAACTTGATCTCCCAA pLKO.1 1713 CDS 100% 2.640 1.848 N TAF4B n/a
11 TRCN0000174249 GCTGTGAACTTGATCTCCCAA pLKO.1 1713 CDS 100% 2.640 1.848 N TAF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.