Transcript: Human XM_017025986.1

PREDICTED: Homo sapiens centrosomal protein 76 (CEP76), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP76 (79959)
Length:
2427
CDS:
501..1946

Additional Resources:

NCBI RefSeq record:
XM_017025986.1
NBCI Gene record:
CEP76 (79959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435420 ACGACTTTAGTAGCATCATAT pLKO_005 579 CDS 100% 13.200 18.480 N CEP76 n/a
2 TRCN0000128632 CACATTTAAAGGGTTCCCAAT pLKO.1 1739 CDS 100% 4.050 5.670 N CEP76 n/a
3 TRCN0000148554 CTTCTTGATACTCCAAGGCAA pLKO.1 960 CDS 100% 2.640 3.696 N CEP76 n/a
4 TRCN0000149037 GCTTGTAAATATCGCTCGGTA pLKO.1 1920 CDS 100% 2.640 3.696 N CEP76 n/a
5 TRCN0000252464 TGCAGAGAAAGAGCGATTATT pLKO_005 794 CDS 100% 15.000 10.500 N Cep76 n/a
6 TRCN0000414934 TGCAGAGAAAGAGCGATTATT pLKO_005 794 CDS 100% 15.000 10.500 N CEP76 n/a
7 TRCN0000128464 GCAGTAGAAACCTGTGTATTT pLKO.1 1386 CDS 100% 13.200 9.240 N CEP76 n/a
8 TRCN0000431999 TTGATAGACAATCGACATTAA pLKO_005 235 5UTR 100% 13.200 9.240 N CEP76 n/a
9 TRCN0000147582 GAACTAGAATGGCTGATTCAA pLKO.1 493 5UTR 100% 5.625 3.938 N CEP76 n/a
10 TRCN0000147613 GAGATGTTTGTCTAAGGGTTT pLKO.1 2278 3UTR 100% 4.050 2.835 N CEP76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04152 pDONR223 100% 72.9% 72.9% None 0_1ins534 n/a
2 ccsbBroad304_04152 pLX_304 0% 72.9% 72.9% V5 0_1ins534 n/a
3 TRCN0000477682 ACCATTGCAGGGAATCATGTTCTG pLX_317 22.5% 72.9% 72.9% V5 0_1ins534 n/a
Download CSV