Transcript: Human XM_017026038.2

PREDICTED: Homo sapiens elastin microfibril interfacer 2 (EMILIN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EMILIN2 (84034)
Length:
2746
CDS:
147..2645

Additional Resources:

NCBI RefSeq record:
XM_017026038.2
NBCI Gene record:
EMILIN2 (84034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160476 CTGAAGTCAAAGATACTCTAA pLKO.1 946 CDS 100% 4.950 3.465 N EMILIN2 n/a
2 TRCN0000163929 GCTGGACTCTATCTCAGGAAA pLKO.1 2291 CDS 100% 4.950 3.465 N EMILIN2 n/a
3 TRCN0000163003 GCTGGTGTATCGAGTGAACTT pLKO.1 398 CDS 100% 4.950 3.465 N EMILIN2 n/a
4 TRCN0000159857 GATGGAATTAAACCACCTGAA pLKO.1 1754 CDS 100% 4.050 2.835 N EMILIN2 n/a
5 TRCN0000162978 GCTGAATGGAAGACTGGACAA pLKO.1 1421 CDS 100% 4.050 2.835 N EMILIN2 n/a
6 TRCN0000160353 CCTAGATATGTCACTAGGTAT pLKO.1 423 CDS 100% 0.495 0.347 N EMILIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14301 pDONR223 100% 77.9% 68.6% None (many diffs) n/a
2 ccsbBroad304_14301 pLX_304 0% 77.9% 68.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481432 TGCGAGCCACCGCGAAGAGGTGTG pLX_317 11.5% 77.9% 68.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV