Transcript: Human XM_017026424.2

PREDICTED: Homo sapiens zinc finger protein 383 (ZNF383), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF383 (163087)
Length:
3006
CDS:
308..1735

Additional Resources:

NCBI RefSeq record:
XM_017026424.2
NBCI Gene record:
ZNF383 (163087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232363 TCCTTACTCTCCATCAAATAA pLKO_005 774 CDS 100% 15.000 12.000 N ZNF383 n/a
2 TRCN0000232359 CCTCAAGTGATCTCCTTATTG pLKO_005 461 CDS 100% 13.200 9.240 N ZNF383 n/a
3 TRCN0000020014 CCTGAATACATGCCCACATTT pLKO.1 740 CDS 100% 13.200 9.240 N ZNF383 n/a
4 TRCN0000232360 GATGTGTGAAACCAAGTTATT pLKO_005 550 CDS 100% 13.200 9.240 N ZNF383 n/a
5 TRCN0000020015 GCCTCAAGTGATCTCCTTATT pLKO.1 460 CDS 100% 13.200 9.240 N ZNF383 n/a
6 TRCN0000232361 TTATGCCAGAGGGAGATAATG pLKO_005 602 CDS 100% 13.200 9.240 N ZNF383 n/a
7 TRCN0000232362 GGGATATCCAAATGGGCATTT pLKO_005 700 CDS 100% 10.800 7.560 N ZNF383 n/a
8 TRCN0000020018 GTAGTGGCTCAGCACTTACTA pLKO.1 1350 CDS 100% 5.625 3.938 N ZNF383 n/a
9 TRCN0000020016 CAGAGGGAGATAATGGGACTT pLKO.1 608 CDS 100% 4.050 2.835 N ZNF383 n/a
10 TRCN0000020017 TGCTCAAATCTTATTGACCAT pLKO.1 1103 CDS 100% 2.640 1.848 N ZNF383 n/a
11 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1064 CDS 100% 4.950 2.475 Y ZNF829 n/a
12 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 1217 CDS 100% 4.050 2.025 Y ZNF260 n/a
13 TRCN0000152739 GTAAGGAATGTGGAAAGGCTT pLKO.1 1410 CDS 100% 2.640 1.320 Y ZNF829 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2411 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1065 CDS 100% 5.625 2.813 Y ZNF570 n/a
16 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1070 CDS 100% 4.050 2.025 Y ZNF700 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2411 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13630 pDONR223 100% 45.1% 43.7% None (many diffs) n/a
2 ccsbBroad304_13630 pLX_304 0% 45.1% 43.7% V5 (many diffs) n/a
3 TRCN0000476332 ACTTGCTCCCCATCGACTATTATC pLX_317 22.5% 45.1% 43.7% V5 (many diffs) n/a
Download CSV