Transcript: Human XM_017026511.1

PREDICTED: Homo sapiens microtubule associated serine/threonine kinase 3 (MAST3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAST3 (23031)
Length:
6361
CDS:
352..4395

Additional Resources:

NCBI RefSeq record:
XM_017026511.1
NBCI Gene record:
MAST3 (23031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230626 AGCCATGCGAAAGCGACTTTG pLKO_005 1520 CDS 100% 10.800 15.120 N MAST3 n/a
2 TRCN0000021442 GAGCGTGACATTCTCACCTTT pLKO.1 1681 CDS 100% 4.950 6.930 N MAST3 n/a
3 TRCN0000219053 GCAAATCCCTGCAACTAATTT pLKO_005 4619 3UTR 100% 15.000 10.500 N MAST3 n/a
4 TRCN0000230625 TTGGATAGTCCTCGGAATTTC pLKO_005 592 CDS 100% 13.200 9.240 N MAST3 n/a
5 TRCN0000230628 CACTCCTACCTTCGCTGAAAG pLKO_005 2592 CDS 100% 10.800 7.560 N MAST3 n/a
6 TRCN0000195170 CTATGTATGGTCATGGAATAC pLKO.1 1756 CDS 100% 10.800 7.560 N MAST3 n/a
7 TRCN0000230627 TGGAGTACCTGCATAACTATG pLKO_005 1871 CDS 100% 10.800 7.560 N MAST3 n/a
8 TRCN0000021441 GCTGGAGTACCTGCATAACTA pLKO.1 1869 CDS 100% 5.625 3.938 N MAST3 n/a
9 TRCN0000021443 TGCCCAAGTTTGCCTTCTCAT pLKO.1 2795 CDS 100% 4.950 3.465 N MAST3 n/a
10 TRCN0000195526 CACTGATAAAGGAAGGTACAG pLKO.1 5479 3UTR 100% 4.050 2.835 N MAST3 n/a
11 TRCN0000199645 GCGCCGAGACTCCTTCAAGAA pLKO.1 4239 CDS 100% 1.650 1.155 N MAST3 n/a
12 TRCN0000197052 GCGACTTTGAGACCATCAAAC pLKO.1 1532 CDS 100% 1.080 0.756 N MAST3 n/a
13 TRCN0000021440 CCTTGGATAGTCCTCGGAATT pLKO.1 590 CDS 100% 0.000 0.000 N MAST3 n/a
14 TRCN0000200003 CGAGCCTTTCTGCCGACACAG pLKO.1 2924 CDS 100% 0.000 0.000 N MAST3 n/a
15 TRCN0000194968 CTTTGTAAATAGCAGCAAATC pLKO.1 4605 3UTR 100% 10.800 6.480 N MAST3 n/a
16 TRCN0000021439 CCCAGCCTAATTTATTACTTT pLKO.1 4948 3UTR 100% 5.625 3.375 N MAST3 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4912 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000199331 CACATCAAGCTCACGGACTTT pLKO.1 1945 CDS 100% 4.950 2.475 Y PRKY n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4912 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489717 TTTCATTAGAAACCTGAATTGTAC pLX_317 17.5% 48.7% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491941 ATCCCACGGCATTCTGCCTCAGCT pLX_317 21.1% 48.7% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV