Transcript: Human XM_017026609.1

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 1 (ZSCAN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN1 (284312)
Length:
2381
CDS:
687..1544

Additional Resources:

NCBI RefSeq record:
XM_017026609.1
NBCI Gene record:
ZSCAN1 (284312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433272 ATGTGCCAGCAGGAAGTTCTG pLKO_005 1161 CDS 100% 4.050 2.835 N ZSCAN1 n/a
2 TRCN0000015940 GAAGAGTCCAAGGTCCCAGAA pLKO.1 1238 CDS 100% 4.050 2.835 N ZSCAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13523 pDONR223 100% 53.7% 44.2% None (many diffs) n/a
2 ccsbBroad304_13523 pLX_304 0% 53.7% 44.2% V5 (many diffs) n/a
3 TRCN0000471331 AGCATCAGCGTCTGGCTGGGGGAA pLX_317 77.6% 53.7% 44.2% V5 (many diffs) n/a
Download CSV