Transcript: Human XM_017026666.1

PREDICTED: Homo sapiens V-set and transmembrane domain containing 1 (VSTM1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VSTM1 (284415)
Length:
764
CDS:
190..714

Additional Resources:

NCBI RefSeq record:
XM_017026666.1
NBCI Gene record:
VSTM1 (284415)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163270 GTGGTCACAGATAAACACGAT pLKO.1 535 CDS 100% 2.640 2.112 N VSTM1 n/a
2 TRCN0000162685 CATTCCCAGAATGTGACATTT pLKO.1 343 CDS 100% 13.200 9.240 N VSTM1 n/a
3 TRCN0000437492 AGGAACAGAGCTCGGCAGAAA pLKO_005 398 CDS 100% 4.950 3.465 N VSTM1 n/a
4 TRCN0000163011 GTCAGAAAGCAGTGAACACTT pLKO.1 507 CDS 100% 4.950 3.465 N VSTM1 n/a
5 TRCN0000429005 TAAGGATGCTGGGAGGTACTT pLKO_005 453 CDS 100% 4.950 3.465 N VSTM1 n/a
6 TRCN0000161129 GTCACAGATAAACACGATGAA pLKO.1 538 CDS 100% 4.950 2.970 N VSTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13528 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13528 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472380 GGTTCGCAAGGGAGCGTAGCGTGA pLX_317 91.5% 100% 100% V5 n/a
Download CSV