Transcript: Human XM_017026731.1

PREDICTED: Homo sapiens hepsin (HPN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPN (3249)
Length:
2038
CDS:
499..1752

Additional Resources:

NCBI RefSeq record:
XM_017026731.1
NBCI Gene record:
HPN (3249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073355 TGGCGCTGACTTCTATGGAAA pLKO.1 1467 CDS 100% 4.950 6.930 N HPN n/a
2 TRCN0000436157 ACGCAGTACTATGGCCAACAG pLKO_005 1393 CDS 100% 4.050 5.670 N HPN n/a
3 TRCN0000222315 GCCATAAAGACTCACTCCGAA pLKO.1 1705 CDS 100% 2.640 3.696 N Hpn n/a
4 TRCN0000423275 AGTCAGCCTTCGCTATGATGG pLKO_005 1029 CDS 100% 4.050 3.240 N HPN n/a
5 TRCN0000073353 GAGGAGAACAGCAACGATATT pLKO.1 1252 CDS 100% 13.200 9.240 N HPN n/a
6 TRCN0000423816 TGGATCTTCCAGGCCATAAAG pLKO_005 1693 CDS 100% 13.200 9.240 N HPN n/a
7 TRCN0000222612 CTACACCAAAGTCAGTGACTT pLKO.1 1665 CDS 100% 4.950 3.465 N HPN n/a
8 TRCN0000073354 GCGAGGAGAACAGCAACGATA pLKO.1 1250 CDS 100% 4.950 3.465 N HPN n/a
9 TRCN0000418826 ACGCTCGGCTCATGGTCTTTG pLKO_005 677 CDS 100% 3.600 2.520 N HPN n/a
10 TRCN0000073356 CCTGCTACTTCTGACAGCCAT pLKO.1 573 CDS 100% 2.640 1.848 N HPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06398 pDONR223 100% 99.9% 100% None 609C>T n/a
2 ccsbBroad304_06398 pLX_304 0% 99.9% 100% V5 609C>T n/a
3 TRCN0000481151 GGTAATGCAGGCCTGACCACTTTC pLX_317 32.1% 99.9% 100% V5 609C>T n/a
Download CSV