Transcript: Human XM_017026732.1

PREDICTED: Homo sapiens hepsin (HPN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPN (3249)
Length:
1485
CDS:
145..1326

Additional Resources:

NCBI RefSeq record:
XM_017026732.1
NBCI Gene record:
HPN (3249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073355 TGGCGCTGACTTCTATGGAAA pLKO.1 1029 CDS 100% 4.950 6.930 N HPN n/a
2 TRCN0000436157 ACGCAGTACTATGGCCAACAG pLKO_005 955 CDS 100% 4.050 5.670 N HPN n/a
3 TRCN0000423275 AGTCAGCCTTCGCTATGATGG pLKO_005 591 CDS 100% 4.050 3.240 N HPN n/a
4 TRCN0000073353 GAGGAGAACAGCAACGATATT pLKO.1 814 CDS 100% 13.200 9.240 N HPN n/a
5 TRCN0000423816 TGGATCTTCCAGGCCATAAAG pLKO_005 1255 CDS 100% 13.200 9.240 N HPN n/a
6 TRCN0000222612 CTACACCAAAGTCAGTGACTT pLKO.1 1227 CDS 100% 4.950 3.465 N HPN n/a
7 TRCN0000073354 GCGAGGAGAACAGCAACGATA pLKO.1 812 CDS 100% 4.950 3.465 N HPN n/a
8 TRCN0000418826 ACGCTCGGCTCATGGTCTTTG pLKO_005 239 CDS 100% 3.600 2.520 N HPN n/a
9 TRCN0000073356 CCTGCTACTTCTGACAGCCAT pLKO.1 59 5UTR 100% 2.640 1.848 N HPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06398 pDONR223 100% 88.1% 81.6% None (many diffs) n/a
2 ccsbBroad304_06398 pLX_304 0% 88.1% 81.6% V5 (many diffs) n/a
3 TRCN0000481151 GGTAATGCAGGCCTGACCACTTTC pLX_317 32.1% 88.1% 81.6% V5 (many diffs) n/a
Download CSV