Transcript: Human XM_017026808.2

PREDICTED: Homo sapiens acid phosphatase 7, tartrate resistant (putative) (ACP7), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACP7 (390928)
Length:
3423
CDS:
811..1467

Additional Resources:

NCBI RefSeq record:
XM_017026808.2
NBCI Gene record:
ACP7 (390928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359840 TTCTCCACCGAGGTCTATTTC pLKO_005 874 CDS 100% 13.200 18.480 N ACP7 n/a
2 TRCN0000051302 GTTACTGTCTACTCCTGCTAT pLKO.1 303 5UTR 100% 4.950 6.930 N ACP7 n/a
3 TRCN0000051300 CGACCTCCAGAAAGCCAATAA pLKO.1 948 CDS 100% 13.200 9.240 N ACP7 n/a
4 TRCN0000359838 GAACGACTGTGGCCAATTTAC pLKO_005 1162 CDS 100% 13.200 9.240 N ACP7 n/a
5 TRCN0000359839 GACCTCCAGAAAGCCAATAAG pLKO_005 949 CDS 100% 13.200 9.240 N ACP7 n/a
6 TRCN0000051299 CCAATTTACAACTACCAGGTA pLKO.1 1174 CDS 100% 2.640 1.848 N ACP7 n/a
7 TRCN0000051298 GCTTCAGGAATGAAGAGGCTT pLKO.1 1767 3UTR 100% 0.264 0.185 N ACP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10109 pDONR223 100% 49.7% 49.7% None 0_1ins660 n/a
2 ccsbBroad304_10109 pLX_304 0% 49.7% 49.7% V5 0_1ins660 n/a
3 TRCN0000480326 TTCTGTCTCCTGTTCGATCCATGC pLX_317 27.5% 49.7% 49.7% V5 0_1ins660 n/a
Download CSV