Transcript: Human XM_017026811.1

PREDICTED: Homo sapiens mex-3 RNA binding family member D (MEX3D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEX3D (399664)
Length:
2647
CDS:
503..1756

Additional Resources:

NCBI RefSeq record:
XM_017026811.1
NBCI Gene record:
MEX3D (399664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016393 CAGCCCTTCAACGACAGTATT pLKO.1 1966 3UTR 100% 13.200 18.480 N MEX3D n/a
2 TRCN0000235937 GAGTGGTCAGGTTACAATAAA pLKO_005 1987 3UTR 100% 15.000 10.500 N MEX3D n/a
3 TRCN0000235933 GGCCGAACACTTCTCCATCAT pLKO_005 529 CDS 100% 4.950 3.465 N MEX3D n/a
4 TRCN0000235936 GGCCACCCAGGCCATTCATAT pLKO_005 1726 CDS 100% 4.400 3.080 N MEX3D n/a
5 TRCN0000235934 CTTCGGCTTCGACTTCGACTT pLKO_005 1156 CDS 100% 4.050 2.835 N MEX3D n/a
6 TRCN0000016395 CGGCTTCGACTTCGACTTCCT pLKO.1 1159 CDS 100% 0.880 0.616 N MEX3D n/a
7 TRCN0000016397 CGACAGCGACTTCCACGCCAA pLKO.1 850 CDS 100% 0.000 0.000 N MEX3D n/a
8 TRCN0000145938 CGACAGCGACTTCCACGCCAA pLKO.1 850 CDS 100% 0.000 0.000 N MEX3D n/a
9 TRCN0000016396 GCGCGACAAGGAGCCGGTGTT pLKO.1 733 CDS 100% 0.000 0.000 N MEX3D n/a
10 TRCN0000016394 CAAGACAAACACCTACATCAA pLKO.1 421 5UTR 100% 4.950 2.970 N MEX3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470439 CCTGACGACTCTCAATGGACTAGC pLX_317 22.7% 84.7% 84.4% V5 (many diffs) n/a
Download CSV