Transcript: Human XM_017027035.1

PREDICTED: Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD1A (57655)
Length:
2769
CDS:
16..2439

Additional Resources:

NCBI RefSeq record:
XM_017027035.1
NBCI Gene record:
GRAMD1A (57655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427036 ACGGAACCGAGATGCACTTTA pLKO_005 2585 3UTR 100% 13.200 18.480 N GRAMD1A n/a
2 TRCN0000423358 AGCGGCATTGAAGACTATTTC pLKO_005 1825 CDS 100% 13.200 18.480 N GRAMD1A n/a
3 TRCN0000136082 GCGAGAAGCATTTCTTCACTT pLKO.1 794 CDS 100% 4.950 6.930 N GRAMD1A n/a
4 TRCN0000423618 CCGAAGCAGAACGCCTCATTG pLKO_005 578 CDS 100% 3.600 2.880 N GRAMD1A n/a
5 TRCN0000136936 CGCTCATTGAGAAGAACTCGT pLKO.1 1802 CDS 100% 2.640 2.112 N GRAMD1A n/a
6 TRCN0000430867 ATGCAGAGCTGGTACAGTATG pLKO_005 499 CDS 100% 10.800 7.560 N GRAMD1A n/a
7 TRCN0000135074 CCCACTTATAAGCAGCGTAAT pLKO.1 526 CDS 100% 10.800 7.560 N GRAMD1A n/a
8 TRCN0000135911 GAAGTCGCTCATTGAGAAGAA pLKO.1 1797 CDS 100% 4.950 3.465 N GRAMD1A n/a
9 TRCN0000135216 CAGACACAAGTAACTCCTCTT pLKO.1 1307 CDS 100% 4.050 2.835 N GRAMD1A n/a
10 TRCN0000135376 GTGACATGTCTGAAGAAGGAA pLKO.1 727 CDS 100% 3.000 2.100 N GRAMD1A n/a
11 TRCN0000136423 CTGCTTCTACAGCAACATCTT pLKO.1 669 CDS 100% 4.950 2.475 Y GRAMD1A n/a
12 TRCN0000192431 CGGAAACTGTTCAGCAAACTT pLKO.1 556 CDS 100% 5.625 3.938 N Gramd1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.