Transcript: Human XM_017027075.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type S (PTPRS), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRS (5802)
Length:
6026
CDS:
202..4755

Additional Resources:

NCBI RefSeq record:
XM_017027075.1
NBCI Gene record:
PTPRS (5802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320394 CCTATTACGTCATCGAATATA pLKO_005 1256 CDS 100% 15.000 21.000 N PTPRS n/a
2 TRCN0000002912 GCGCTTTGAGACGATTGAGTT pLKO.1 429 CDS 100% 4.950 6.930 N PTPRS n/a
3 TRCN0000320392 GCGCTTTGAGACGATTGAGTT pLKO_005 429 CDS 100% 4.950 6.930 N PTPRS n/a
4 TRCN0000002913 CGTCATCGAATATAAATCCAA pLKO.1 1263 CDS 100% 3.000 4.200 N PTPRS n/a
5 TRCN0000379920 GAAACCGACCAGGGCAAATAT pLKO_005 796 CDS 100% 15.000 10.500 N PTPRS n/a
6 TRCN0000380207 TGTGGAAATGAGACGCATTAA pLKO_005 2922 CDS 100% 13.200 9.240 N PTPRS n/a
7 TRCN0000002910 CCAGAGCTATTTCATTGTGAT pLKO.1 2373 CDS 100% 4.950 3.465 N PTPRS n/a
8 TRCN0000002914 TACTTGGCACATTCCTCCTTT pLKO.1 4975 3UTR 100% 4.950 3.465 N PTPRS n/a
9 TRCN0000320393 TACTTGGCACATTCCTCCTTT pLKO_005 4975 3UTR 100% 4.950 3.465 N PTPRS n/a
10 TRCN0000002911 CGTGGTCTTCATAATCTGCAT pLKO.1 2796 CDS 100% 2.640 1.848 N PTPRS n/a
11 TRCN0000320463 CGTGGTCTTCATAATCTGCAT pLKO_005 2796 CDS 100% 2.640 1.848 N PTPRS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11081 pDONR223 100% 8.3% 8.3% None 261A>C;377_378delGA;386_4551delinsT n/a
2 ccsbBroad304_11081 pLX_304 0% 8.3% 8.3% V5 261A>C;377_378delGA;386_4551delinsT n/a
3 TRCN0000473717 ATCCACCGAATCTTAAAGGACGCA pLX_317 98.5% 8.3% 8.3% V5 261A>C;377_378delGA;386_4551delinsT n/a
Download CSV