Transcript: Human XM_017027093.1

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit gamma 7 (CACNG7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNG7 (59284)
Length:
2601
CDS:
123..950

Additional Resources:

NCBI RefSeq record:
XM_017027093.1
NBCI Gene record:
CACNG7 (59284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424975 TTATCGCTACGGGTGGTCTTT pLKO_005 638 CDS 100% 4.950 6.930 N CACNG7 n/a
2 TRCN0000435329 CTGTGTGGCCTCAGAATATTT pLKO_005 335 CDS 100% 15.000 10.500 N CACNG7 n/a
3 TRCN0000044301 TCTGGCATCTTCTTCATACTA pLKO.1 522 CDS 100% 5.625 3.938 N CACNG7 n/a
4 TRCN0000440192 ATCAACGACGAGGTCATGAAC pLKO_005 588 CDS 100% 4.950 3.465 N Cacng7 n/a
5 TRCN0000044298 CATCCAAATGACGCAGAACTA pLKO.1 875 CDS 100% 4.950 3.465 N CACNG7 n/a
6 TRCN0000044302 CATCAGCAACATCGGCCACAT pLKO.1 470 CDS 100% 4.050 2.835 N CACNG7 n/a
7 TRCN0000044299 GAGATCAATTTGGTGACGGAA pLKO.1 366 CDS 100% 2.640 1.848 N CACNG7 n/a
8 TRCN0000044300 GCTTCCTCCTTCCTACTCAAA pLKO.1 669 CDS 100% 4.950 2.970 N CACNG7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03873 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03873 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469056 CCCTCCCTGTGCAAACTTCTAATG pLX_317 38.3% 100% 100% V5 n/a
Download CSV