Transcript: Human XM_017027305.1

PREDICTED: Homo sapiens ceramide synthase 4 (CERS4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CERS4 (79603)
Length:
1696
CDS:
188..1372

Additional Resources:

NCBI RefSeq record:
XM_017027305.1
NBCI Gene record:
CERS4 (79603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016984 GAGAAGGACATTCGTAGTGAT pLKO.1 1196 CDS 100% 4.950 6.930 N CERS4 n/a
2 TRCN0000016985 CCTTGCCTTTGAGAGATTCAT pLKO.1 346 CDS 100% 5.625 3.938 N CERS4 n/a
3 TRCN0000016987 CGACGCTCTCTTCCTCATCTT pLKO.1 970 CDS 100% 4.950 3.465 N CERS4 n/a
4 TRCN0000016983 CACCACATACTACGAGTCCAT pLKO.1 1045 CDS 100% 2.640 1.848 N CERS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08935 pDONR223 100% 99.7% 99.4% None 717C>T;1058C>T;1136G>A n/a
2 ccsbBroad304_08935 pLX_304 0% 99.7% 99.4% V5 717C>T;1058C>T;1136G>A n/a
3 TRCN0000467488 AATCTCTAGGTCTCCAGACCACCA pLX_317 30% 99.7% 99.4% V5 717C>T;1058C>T;1136G>A n/a
Download CSV