Transcript: Human XM_017027365.1

PREDICTED: Homo sapiens zinc finger protein 528 (ZNF528), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF528 (84436)
Length:
3641
CDS:
272..1972

Additional Resources:

NCBI RefSeq record:
XM_017027365.1
NBCI Gene record:
ZNF528 (84436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418289 AGTAATCCATAACGCAGATAA pLKO_005 697 CDS 100% 13.200 18.480 N ZNF528 n/a
2 TRCN0000415062 TATAGAACACGATAGGATTTA pLKO_005 2189 3UTR 100% 13.200 18.480 N ZNF528 n/a
3 TRCN0000021097 GCAAAGCATTTCGAGGGTGTT pLKO.1 1749 CDS 100% 4.050 3.240 N ZNF528 n/a
4 TRCN0000420865 AGGCCTTACAGATGTAGTAAA pLKO_005 1724 CDS 100% 13.200 9.240 N ZNF528 n/a
5 TRCN0000425221 CATCATGAGTTCTAGCATTAA pLKO_005 2003 3UTR 100% 13.200 9.240 N ZNF528 n/a
6 TRCN0000424741 CTCTGGTTCTCTGATACTAAT pLKO_005 2228 3UTR 100% 13.200 9.240 N ZNF528 n/a
7 TRCN0000021096 GCTCTTCAGTAGCAATTCAAA pLKO.1 829 CDS 100% 5.625 3.938 N ZNF528 n/a
8 TRCN0000021094 GCTCCATTACTTCCACAAGAA pLKO.1 593 CDS 100% 4.950 3.465 N ZNF528 n/a
9 TRCN0000021095 CCCTCACCAATCACCATAGAA pLKO.1 1857 CDS 100% 5.625 3.375 N ZNF528 n/a
10 TRCN0000021098 GCACACCTTGTACGACATCAA pLKO.1 1013 CDS 100% 4.950 2.970 N ZNF528 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3106 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021816 CTGGAGAGAAACCTTACAGAT pLKO.1 1044 CDS 100% 4.950 2.475 Y ZNF253 n/a
13 TRCN0000155654 CTGGAGAGAAACCTTACAGAT pLKO.1 1044 CDS 100% 4.950 2.475 Y ZNF320 n/a
14 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1133 CDS 100% 4.950 2.475 Y ZNF28 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3106 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.