Transcript: Human XM_017027407.1

PREDICTED: Homo sapiens PTPRF interacting protein alpha 3 (PPFIA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPFIA3 (8541)
Length:
4715
CDS:
350..3907

Additional Resources:

NCBI RefSeq record:
XM_017027407.1
NBCI Gene record:
PPFIA3 (8541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272590 ATGAACGATGACCACAATAAG pLKO_005 1613 CDS 100% 13.200 18.480 N PPFIA3 n/a
2 TRCN0000381649 GCCTGAAACGGCTCAACTATG pLKO_005 3360 CDS 100% 10.800 15.120 N PPFIA3 n/a
3 TRCN0000272589 ACCTCACTCGGACGGAAGAAT pLKO_005 3924 3UTR 100% 5.625 7.875 N PPFIA3 n/a
4 TRCN0000272530 CTAGCAAGGAGTCGTTGTATC pLKO_005 1350 CDS 100% 10.800 8.640 N PPFIA3 n/a
5 TRCN0000380641 AGAAGTGCTCAAAGCTCTAAA pLKO_005 799 CDS 100% 13.200 9.240 N PPFIA3 n/a
6 TRCN0000272529 TGACGAAGGAGCTGAACTTAT pLKO_005 603 CDS 100% 13.200 9.240 N PPFIA3 n/a
7 TRCN0000380527 TCTTCCTTCTTCGTCCGAAAG pLKO_005 4312 3UTR 100% 6.000 4.200 N PPFIA3 n/a
8 TRCN0000002976 GAAGAGCATCAAGTCATCCAT pLKO.1 2629 CDS 100% 3.000 2.100 N PPFIA3 n/a
9 TRCN0000002972 GCTCGAATGTTAGATCACCTT pLKO.1 3263 CDS 100% 2.640 1.848 N PPFIA3 n/a
10 TRCN0000002973 CCGAGGAACGTCATGGGAATT pLKO.1 1512 CDS 100% 0.000 0.000 N PPFIA3 n/a
11 TRCN0000318470 CCGAGGAACGTCATGGGAATT pLKO_005 1512 CDS 100% 0.000 0.000 N PPFIA3 n/a
12 TRCN0000002974 TCACGGGTAAAGAGAACTGTT pLKO.1 4684 3UTR 100% 4.950 2.970 N PPFIA3 n/a
13 TRCN0000002975 GCGGATTACAACACTGGAGAA pLKO.1 1258 CDS 100% 4.050 2.430 N PPFIA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.