Transcript: Human XM_017027442.1

PREDICTED: Homo sapiens coiled-coil domain containing 97 (CCDC97), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC97 (90324)
Length:
1913
CDS:
295..1581

Additional Resources:

NCBI RefSeq record:
XM_017027442.1
NBCI Gene record:
CCDC97 (90324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136295 GTACTTCAGTGATGAGCAGAT pLKO.1 966 CDS 100% 4.050 2.835 N CCDC97 n/a
2 TRCN0000164285 CCCTGCTATATGAGCAGTACA pLKO.1 1001 CDS 100% 0.495 0.347 N CCDC97 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04511 pDONR223 100% 76.4% 68.3% None (many diffs) n/a
2 ccsbBroad304_04511 pLX_304 0% 76.4% 68.3% V5 (many diffs) n/a
3 TRCN0000492281 ATCGGACATTCGTAGATGATTCCG pLX_317 19.2% 76.4% 68.3% V5 (many diffs) n/a
Download CSV