Transcript: Human XM_017027451.1

PREDICTED: Homo sapiens Yip1 interacting factor homolog B, membrane trafficking protein (YIF1B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YIF1B (90522)
Length:
1338
CDS:
92..940

Additional Resources:

NCBI RefSeq record:
XM_017027451.1
NBCI Gene record:
YIF1B (90522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257108 TAAGAACATCGACCGCTTCAT pLKO_005 337 CDS 100% 4.950 6.930 N YIF1B n/a
2 TRCN0000179907 CGTAGCCATCTTTGTGTTCAT pLKO.1 814 CDS 100% 4.950 3.960 N YIF1B n/a
3 TRCN0000244659 TGGCCTTCTTGGGCTACAAAT pLKO_005 714 CDS 100% 13.200 9.240 N YIF1B n/a
4 TRCN0000244660 CATCACCAAGCTCAAGTATTA pLKO_005 361 CDS 100% 13.200 7.920 N YIF1B n/a
5 TRCN0000244658 TGGCTTTCATCACCTACGTTT pLKO_005 531 CDS 100% 4.950 2.970 N YIF1B n/a
6 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 920 CDS 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12941 pDONR223 100% 95.6% 94.5% None (many diffs) n/a
2 ccsbBroad304_12941 pLX_304 0% 95.6% 94.5% V5 (many diffs) n/a
3 TRCN0000467621 CGACGAAGTTCTCCGTGTCATCAA pLX_317 26.1% 95.6% 94.5% V5 (many diffs) n/a
Download CSV