Transcript: Human XM_017027635.1

PREDICTED: Homo sapiens heat shock protein family A (Hsp70) member 12B (HSPA12B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSPA12B (116835)
Length:
1655
CDS:
86..1498

Additional Resources:

NCBI RefSeq record:
XM_017027635.1
NBCI Gene record:
HSPA12B (116835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426709 GCAGCGTGAACTTCGTGAAGT pLKO_005 1383 CDS 100% 4.950 6.930 N HSPA12B n/a
2 TRCN0000130497 GCTCTACTTCGAGAAGTTCAA pLKO.1 496 CDS 100% 4.950 6.930 N HSPA12B n/a
3 TRCN0000149737 GAATGTCTTGTGAAGCCATGA pLKO.1 1425 CDS 100% 4.050 2.835 N HSPA12B n/a
4 TRCN0000150070 CGAGAAGTTCAAGATGAAGAT pLKO.1 505 CDS 100% 4.950 2.970 N HSPA12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09435 pDONR223 100% 68.4% 68.2% None 1406_1406delGinsAGGCCC;1409T>C;1410_1411ins643 n/a
2 ccsbBroad304_09435 pLX_304 0% 68.4% 68.2% V5 1406_1406delGinsAGGCCC;1409T>C;1410_1411ins643 n/a
3 TRCN0000479290 TATCCTCAAGCTTACCCGAACAGT pLX_317 21.2% 68.4% 68.2% V5 1406_1406delGinsAGGCCC;1409T>C;1410_1411ins643 n/a
Download CSV