Transcript: Human XM_017027929.2

PREDICTED: Homo sapiens taspase 1 (TASP1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TASP1 (55617)
Length:
980
CDS:
112..882

Additional Resources:

NCBI RefSeq record:
XM_017027929.2
NBCI Gene record:
TASP1 (55617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425987 AGGAATGGGATCTAATCTAAA pLKO_005 414 CDS 100% 13.200 10.560 N TASP1 n/a
2 TRCN0000005964 CGAGCTTGTCAGAAGGCAATT pLKO.1 310 CDS 100% 10.800 8.640 N TASP1 n/a
3 TRCN0000421536 GAAACAAAGCAGTCCTATAAA pLKO_005 202 CDS 100% 15.000 10.500 N TASP1 n/a
4 TRCN0000005966 CGGTTGCCAACAGACTCTTAT pLKO.1 533 CDS 100% 13.200 9.240 N TASP1 n/a
5 TRCN0000415046 TCTCAGGTTTCGGCTGGTAAA pLKO_005 163 CDS 100% 10.800 7.560 N TASP1 n/a
6 TRCN0000425319 TGCATGCAGGTGCAGGTTATC pLKO_005 248 CDS 100% 10.800 7.560 N TASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487713 TCCGCTATTGTCCTTTTATGTTTA pLX_317 18.6% 58.9% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489233 CCTGGCGAGCATCCCAATCAAGTT pLX_317 28.7% 58.9% 54.8% V5 (many diffs) n/a
Download CSV