Transcript: Human XM_017027932.1

PREDICTED: Homo sapiens breast carcinoma amplified sequence 4 (BCAS4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCAS4 (55653)
Length:
1940
CDS:
24..443

Additional Resources:

NCBI RefSeq record:
XM_017027932.1
NBCI Gene record:
BCAS4 (55653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164585 CAGGAGTGATACTTCACAGAT pLKO.1 278 CDS 100% 4.950 3.960 N BCAS4 n/a
2 TRCN0000166374 CAGTCCTTAAGGCCAAACTGA pLKO.1 316 CDS 100% 3.000 2.400 N BCAS4 n/a
3 TRCN0000164107 CTTAAGGCCAAACTGACAGAA pLKO.1 321 CDS 100% 4.950 3.465 N BCAS4 n/a
4 TRCN0000164842 CCAAACTGACAGAAATGCGTG pLKO.1 328 CDS 100% 2.160 1.512 N BCAS4 n/a
5 TRCN0000165591 GATACTTCACAGATCCTGGAG pLKO.1 285 CDS 100% 2.160 1.512 N BCAS4 n/a
6 TRCN0000164674 CTTCACAGATCCTGGAGGAAA pLKO.1 289 CDS 100% 4.950 2.970 N BCAS4 n/a
7 TRCN0000165307 GCCAAACTGACAGAAATGCGT pLKO.1 327 CDS 100% 0.750 0.450 N BCAS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12241 pDONR223 100% 50.6% 47.2% None (many diffs) n/a
2 ccsbBroad304_12241 pLX_304 0% 50.6% 47.2% V5 (many diffs) n/a
3 TRCN0000480556 CCGTAGATGGCAAGCAAACCACAC pLX_317 59.4% 50.6% 47.2% V5 (many diffs) n/a
Download CSV