Transcript: Human XM_017028048.1

PREDICTED: Homo sapiens zinc finger protein 133 (ZNF133), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF133 (7692)
Length:
3592
CDS:
1448..3412

Additional Resources:

NCBI RefSeq record:
XM_017028048.1
NBCI Gene record:
ZNF133 (7692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235723 TAACCGGAAGTCAACGCTAAT pLKO_005 2284 CDS 100% 10.800 15.120 N ZNF133 n/a
2 TRCN0000015745 CCGGAAGTCAACGCTAATCAT pLKO.1 2287 CDS 100% 5.625 7.875 N ZNF133 n/a
3 TRCN0000015744 CCTTACATCAAATGACACATA pLKO.1 3228 CDS 100% 4.950 3.960 N ZNF133 n/a
4 TRCN0000235722 GCAACCTTCGGATTCCTTATA pLKO_005 3382 CDS 100% 13.200 9.240 N ZNF133 n/a
5 TRCN0000235724 TGGACTGGGCTTTGGCAATAA pLKO_005 3112 CDS 100% 13.200 9.240 N ZNF133 n/a
6 TRCN0000235726 AGTCAGAATGTTGACACTTTG pLKO_005 3439 3UTR 100% 10.800 7.560 N ZNF133 n/a
7 TRCN0000015746 CCTCAACAGACACCAGAACAT pLKO.1 2803 CDS 100% 4.950 3.465 N ZNF133 n/a
8 TRCN0000015747 CCGGGTTTCTCCAGTCAGAAA pLKO.1 1706 CDS 100% 0.495 0.347 N ZNF133 n/a
9 TRCN0000235725 CACCTCACCTTACATCAAATG pLKO_005 3221 CDS 100% 10.800 6.480 N ZNF133 n/a
10 TRCN0000015743 ACAAGGACTAAGAGTCAGAAT pLKO.1 3427 3UTR 100% 4.950 2.970 N ZNF133 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07164 pDONR223 100% 99.5% 99.6% None (many diffs) n/a
2 ccsbBroad304_07164 pLX_304 0% 99.5% 99.6% V5 (many diffs) n/a
3 TRCN0000474044 GCAAACATTTGTGACATTACGAAA pLX_317 18.5% 99.5% 99.6% V5 (many diffs) n/a
Download CSV