Transcript: Human XM_017028266.1

PREDICTED: Homo sapiens BTG anti-proliferation factor 3 (BTG3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTG3 (10950)
Length:
1554
CDS:
356..1114

Additional Resources:

NCBI RefSeq record:
XM_017028266.1
NBCI Gene record:
BTG3 (10950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304131 AGATGTATTCGTGTCAATAAA pLKO_005 527 CDS 100% 15.000 21.000 N BTG3 n/a
2 TRCN0000304194 GACCGGAATCACTGGATTAAT pLKO_005 1070 CDS 100% 15.000 10.500 N BTG3 n/a
3 TRCN0000117855 GCTGAGAAATTGACCCTAATA pLKO.1 446 CDS 100% 13.200 9.240 N BTG3 n/a
4 TRCN0000304133 ATAAACCATATCGCCCAATTC pLKO_005 1014 CDS 100% 10.800 7.560 N BTG3 n/a
5 TRCN0000117852 GCACCTTTGAGAATTTACTTT pLKO.1 1425 3UTR 100% 5.625 3.938 N BTG3 n/a
6 TRCN0000300830 GCACCTTTGAGAATTTACTTT pLKO_005 1425 3UTR 100% 5.625 3.938 N BTG3 n/a
7 TRCN0000117856 CCTGTGTACCAGATTTCAGAA pLKO.1 863 CDS 100% 4.950 3.465 N BTG3 n/a
8 TRCN0000117854 GCATTCATTGTTGCCAGCTTT pLKO.1 686 CDS 100% 4.950 3.465 N BTG3 n/a
9 TRCN0000117853 CCAGGAATGTATCGAGGGAAT pLKO.1 932 CDS 100% 4.050 2.835 N BTG3 n/a
10 TRCN0000300858 CCAGGAATGTATCGAGGGAAT pLKO_005 932 CDS 100% 4.050 2.835 N BTG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02569 pDONR223 100% 85.1% 85.1% None 311_312ins132 n/a
2 ccsbBroad304_02569 pLX_304 0% 85.1% 85.1% V5 311_312ins132 n/a
3 TRCN0000470746 TACCCCCTCCAAGTATCTCAAATC pLX_317 47.1% 85.1% 85.1% V5 311_312ins132 n/a
Download CSV