Transcript: Human XM_017028283.1

PREDICTED: Homo sapiens regulator of calcineurin 1 (RCAN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RCAN1 (1827)
Length:
2816
CDS:
383..1216

Additional Resources:

NCBI RefSeq record:
XM_017028283.1
NBCI Gene record:
RCAN1 (1827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256295 ACTAACCTTTGTTCGTATATA pLKO_005 1749 3UTR 100% 15.000 21.000 N RCAN1 n/a
2 TRCN0000019845 CCTCTTTAGGACGTATGACAA pLKO.1 724 CDS 100% 4.950 6.930 N RCAN1 n/a
3 TRCN0000265773 TGAATTGCACGCAGCGACTGA pLKO_005 1054 CDS 100% 2.640 3.696 N RCAN1 n/a
4 TRCN0000256292 CGATCCACCTCAGCTGAACTG pLKO_005 1200 CDS 100% 1.350 1.890 N RCAN1 n/a
5 TRCN0000256296 TTGCTCAGACCTTACACATAG pLKO_005 876 CDS 100% 10.800 8.640 N RCAN1 n/a
6 TRCN0000256297 GGAAAGGAAATGAAGTTATAT pLKO_005 854 CDS 100% 15.000 10.500 N RCAN1 n/a
7 TRCN0000256299 GTCTGGTAAATAGGTATTATA pLKO_005 2462 3UTR 100% 15.000 10.500 N RCAN1 n/a
8 TRCN0000019844 GCTTCAAACGAGTCAGAATAA pLKO.1 771 CDS 100% 13.200 9.240 N RCAN1 n/a
9 TRCN0000256294 GAAAGAATGAGGAGACCTAAG pLKO_005 1142 CDS 100% 6.000 4.200 N RCAN1 n/a
10 TRCN0000019846 CCAAATCCAGACAAGCAGTTT pLKO.1 917 CDS 100% 4.950 3.465 N RCAN1 n/a
11 TRCN0000019847 GTCCATGTATGTGAGAGTGAT pLKO.1 1094 CDS 100% 4.950 3.465 N RCAN1 n/a
12 TRCN0000256298 ATGATCTCTTATATGCCATCT pLKO_005 1008 CDS 100% 4.050 2.835 N RCAN1 n/a
13 TRCN0000256291 CCAGCTGCATAAGACTGAGTT pLKO_005 829 CDS 100% 4.950 2.970 N RCAN1 n/a
14 TRCN0000256293 GGATGGAAACAAGTGGAAGAT pLKO_005 968 CDS 100% 4.950 2.970 N RCAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10788 pDONR223 100% 68.6% 61.6% None (many diffs) n/a
2 ccsbBroad304_10788 pLX_304 0% 68.6% 61.6% V5 (many diffs) n/a
3 TRCN0000474237 AATGCATTGCCCTCAATCATTTTC pLX_317 89.8% 68.6% 61.6% V5 (many diffs) n/a
Download CSV