Transcript: Human XM_017028418.1

PREDICTED: Homo sapiens eva-1 homolog C (EVA1C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EVA1C (59271)
Length:
2058
CDS:
539..1861

Additional Resources:

NCBI RefSeq record:
XM_017028418.1
NBCI Gene record:
EVA1C (59271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420511 TTGTCCAGGAAGCAGTAAATA pLKO_005 967 CDS 100% 15.000 21.000 N EVA1C n/a
2 TRCN0000413845 TACAGTGCCCTCGGCATTCTA pLKO_005 762 CDS 100% 5.625 7.875 N EVA1C n/a
3 TRCN0000419722 ATCTTGATGCGATCGCACTTT pLKO_005 1873 3UTR 100% 4.950 6.930 N EVA1C n/a
4 TRCN0000148324 CCCTTTCGATTGCTTGTCTTA pLKO.1 1162 CDS 100% 4.950 6.930 N EVA1C n/a
5 TRCN0000180601 GTTCTGGTTCACCTGTACCTT pLKO.1 1926 3UTR 100% 3.000 4.200 N EVA1C n/a
6 TRCN0000147081 CATCGTCAACAATCACCATTT pLKO.1 1237 CDS 100% 10.800 8.640 N EVA1C n/a
7 TRCN0000418845 GATTGAGCGCAGGGAGCAAAT pLKO_005 1771 CDS 100% 10.800 7.560 N EVA1C n/a
8 TRCN0000429296 GTTCACCTGTACCTTCTATGA pLKO_005 1932 3UTR 100% 4.950 3.465 N EVA1C n/a
9 TRCN0000148464 CCATGAATCCAAGTTCCTCAA pLKO.1 1069 CDS 100% 4.050 2.835 N EVA1C n/a
10 TRCN0000146984 CCTTCTTTGAAGCAGAAAGAT pLKO.1 1364 CDS 100% 0.563 0.394 N EVA1C n/a
11 TRCN0000180141 CGCATGTGTTCCCAAGAACAT pLKO.1 1306 CDS 100% 0.495 0.347 N EVA1C n/a
12 TRCN0000183466 GTACCTTCTATGAAGGAGAAT pLKO.1 1940 3UTR 100% 0.000 0.000 N EVA1C n/a
13 TRCN0000417216 GAAGAAGGAAGGATCCCAAAT pLKO_005 1896 3UTR 100% 10.800 6.480 N EVA1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12422 pDONR223 100% 99% 98.8% None 56C>A;355_356insAGA;845_853delATGGTGAAT n/a
2 ccsbBroad304_12422 pLX_304 0% 99% 98.8% V5 56C>A;355_356insAGA;845_853delATGGTGAAT n/a
3 TRCN0000465946 ATGACGTAGCCCATCTAACAAATT pLX_317 27.2% 99% 98.8% V5 56C>A;355_356insAGA;845_853delATGGTGAAT n/a
Download CSV