Transcript: Human XM_017028477.1

PREDICTED: Homo sapiens chromatin assembly factor 1 subunit B (CHAF1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHAF1B (8208)
Length:
3172
CDS:
1032..2711

Additional Resources:

NCBI RefSeq record:
XM_017028477.1
NBCI Gene record:
CHAF1B (8208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074280 GCAAGAAGCTACCGGATGTTT pLKO.1 1695 CDS 100% 5.625 7.875 N CHAF1B n/a
2 TRCN0000074279 CGTCATACCAAAGCCGTCAAT pLKO.1 1221 CDS 100% 4.950 6.930 N CHAF1B n/a
3 TRCN0000074282 GCGAGTATACAGTATACAGAA pLKO.1 1616 CDS 100% 4.950 3.960 N CHAF1B n/a
4 TRCN0000074281 CATCCTATTGTGGAAGGTGAA pLKO.1 1298 CDS 100% 4.050 2.835 N CHAF1B n/a
5 TRCN0000074278 GCTGTTGTATTCAGTATCCAT pLKO.1 2878 3UTR 100% 3.000 2.100 N CHAF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01870 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01870 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470290 GCCAATCTAAGGCACACCCGCACG pLX_317 27.2% 100% 100% V5 n/a
Download CSV