Transcript: Human XM_017028625.1

PREDICTED: Homo sapiens HORMA domain containing 2 (HORMAD2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HORMAD2 (150280)
Length:
828
CDS:
124..813

Additional Resources:

NCBI RefSeq record:
XM_017028625.1
NBCI Gene record:
HORMAD2 (150280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443169 GTCCCGGGTCACTGCATATTA pLKO_005 126 CDS 100% 15.000 21.000 N HORMAD2 n/a
2 TRCN0000127782 GCAGCAGTACAAGCTTTGAAA pLKO.1 227 CDS 100% 5.625 3.938 N HORMAD2 n/a
3 TRCN0000127569 CAGTGTTCTACTGATCCGTAA pLKO.1 279 CDS 100% 4.050 2.835 N HORMAD2 n/a
4 TRCN0000127821 GAACAATCTGTTTCGGGAGAA pLKO.1 546 CDS 100% 4.050 2.835 N HORMAD2 n/a
5 TRCN0000128886 GAAGAAGAATGCAATGACCAT pLKO.1 610 CDS 100% 2.640 1.848 N HORMAD2 n/a
6 TRCN0000127726 GTTTGACAAGGAGCCTATCAA pLKO.1 441 CDS 100% 5.625 3.375 N HORMAD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05038 pDONR223 100% 56.8% 50.4% None (many diffs) n/a
2 ccsbBroad304_05038 pLX_304 0% 56.8% 50.4% V5 (many diffs) n/a
3 TRCN0000467171 AATTCCAATACGTCGGGCCACCTA pLX_317 38% 56.8% 50.4% V5 (many diffs) n/a
Download CSV