Transcript: Human XM_017028673.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 28 (TTC28), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC28 (23331)
Length:
11769
CDS:
207..7562

Additional Resources:

NCBI RefSeq record:
XM_017028673.2
NBCI Gene record:
TTC28 (23331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338875 AGAGAAGAGCACCGGATATAT pLKO_005 866 CDS 100% 15.000 21.000 N TTC28 n/a
2 TRCN0000338877 TAGGAAACCTGGGCGATATAT pLKO_005 2266 CDS 100% 15.000 12.000 N TTC28 n/a
3 TRCN0000338876 TTCTACAGGAAAGTGTTATAT pLKO_005 8040 3UTR 100% 15.000 10.500 N TTC28 n/a
4 TRCN0000350999 ACTATGAGGAAGCTATCAAAT pLKO_005 2791 CDS 100% 13.200 9.240 N TTC28 n/a
5 TRCN0000338878 GTACGACCAGGCGGTCAAATA pLKO_005 1703 CDS 100% 13.200 9.240 N TTC28 n/a
6 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 10377 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479319 TGAAGCCACGTGCATCACTTGCCA pLX_317 12.3% 51.1% 51.1% V5 1_3591del n/a
2 ccsbBroadEn_14077 pDONR223 100% 51.1% 51.1% None 1_3591del;7335T>A n/a
3 ccsbBroad304_14077 pLX_304 0% 51.1% 51.1% V5 1_3591del;7335T>A n/a
Download CSV