Transcript: Human XM_017028724.1

PREDICTED: Homo sapiens apolipoprotein L2 (APOL2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOL2 (23780)
Length:
2560
CDS:
16..1365

Additional Resources:

NCBI RefSeq record:
XM_017028724.1
NBCI Gene record:
APOL2 (23780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296614 TTGAGGATTACCTTAAGTATT pLKO_005 377 CDS 100% 13.200 9.240 N APOL2 n/a
2 TRCN0000310235 GACCAAAGCGGCACCAATGTA pLKO_005 904 CDS 100% 5.625 3.938 N APOL2 n/a
3 TRCN0000083107 GCTCAACTTTCTCACCAAGAT pLKO.1 1311 CDS 100% 4.950 3.465 N APOL2 n/a
4 TRCN0000290388 GCTCAACTTTCTCACCAAGAT pLKO_005 1311 CDS 100% 4.950 3.465 N APOL2 n/a
5 TRCN0000083105 GCAGTGTGGTAGAACTAGTAA pLKO.1 848 CDS 100% 0.000 0.000 N APOL2 n/a
6 TRCN0000290315 GCAGTGTGGTAGAACTAGTAA pLKO_005 848 CDS 100% 0.000 0.000 N APOL2 n/a
7 TRCN0000083103 CCTTCCAAGAATAAAGTCTTT pLKO.1 2118 3UTR 100% 4.950 2.970 N APOL2 n/a
8 TRCN0000083106 TGTTCTTACCTTAGTTGACAA pLKO.1 966 CDS 100% 4.950 2.970 N APOL2 n/a
9 TRCN0000290384 TGTTCTTACCTTAGTTGACAA pLKO_005 966 CDS 100% 4.950 2.970 N APOL2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1693 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1693 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07933 pDONR223 100% 74.9% 74.8% None 1_336del;342C>N n/a
2 ccsbBroad304_07933 pLX_304 0% 74.9% 74.8% V5 1_336del;342C>N n/a
Download CSV