Transcript: Human XM_017028752.1

PREDICTED: Homo sapiens tubulin tyrosine ligase like 1 (TTLL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL1 (25809)
Length:
1563
CDS:
155..1426

Additional Resources:

NCBI RefSeq record:
XM_017028752.1
NBCI Gene record:
TTLL1 (25809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048525 CGGCTCTCAGATGACCAAATA pLKO.1 317 CDS 100% 13.200 10.560 N TTLL1 n/a
2 TRCN0000048527 CCGGTTCTGCACAGTGAAATA pLKO.1 811 CDS 100% 13.200 9.240 N TTLL1 n/a
3 TRCN0000048524 CCTCAAGTACAACCTGATTAA pLKO.1 1180 CDS 100% 13.200 9.240 N TTLL1 n/a
4 TRCN0000446018 GGCAAGTGGACAGTGAGTAAC pLKO_005 926 CDS 100% 10.800 7.560 N TTLL1 n/a
5 TRCN0000048526 GCCGGTGATGAACAATGACAA pLKO.1 1045 CDS 100% 4.950 3.465 N TTLL1 n/a
6 TRCN0000048523 GCCTACGTGATCTCTCTCTAT pLKO.1 683 CDS 100% 4.950 3.465 N TTLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02860 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02860 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472148 TGATGTTCGCCCGTATGGCTTGCC pLX_317 36.6% 100% 100% V5 n/a
Download CSV