Transcript: Human XM_017028766.1

PREDICTED: Homo sapiens RIB43A domain with coiled-coils 2 (RIBC2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIBC2 (26150)
Length:
1421
CDS:
119..700

Additional Resources:

NCBI RefSeq record:
XM_017028766.1
NBCI Gene record:
RIBC2 (26150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243070 CCAGAAACTCGCCGTGAATTT pLKO_005 443 CDS 100% 13.200 18.480 N RIBC2 n/a
2 TRCN0000243074 ATTCATGGGAGAGGATTTAAA pLKO_005 553 CDS 100% 15.000 10.500 N RIBC2 n/a
3 TRCN0000243072 ATCTCTGTAGGGCTATCAATG pLKO_005 399 CDS 100% 10.800 7.560 N RIBC2 n/a
4 TRCN0000166901 CAGATAATGATGTTCGGAATA pLKO.1 513 CDS 100% 10.800 7.560 N RIBC2 n/a
5 TRCN0000243073 CAGATAATGATGTTCGGAATA pLKO_005 513 CDS 100% 10.800 7.560 N RIBC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11818 pDONR223 100% 30.3% 29.5% None (many diffs) n/a
2 ccsbBroad304_11818 pLX_304 0% 30.3% 29.5% V5 (many diffs) n/a
3 TRCN0000470313 ACTCCGAGAGACGGAGCACACTAC pLX_317 40.7% 30.3% 29.5% V5 (many diffs) n/a
Download CSV