Transcript: Human XM_017028908.1

PREDICTED: Homo sapiens parvin gamma (PARVG), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARVG (64098)
Length:
2667
CDS:
1485..2438

Additional Resources:

NCBI RefSeq record:
XM_017028908.1
NBCI Gene record:
PARVG (64098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413189 GGACGTCTTTGATGAATTATT pLKO_005 2027 CDS 100% 15.000 21.000 N PARVG n/a
2 TRCN0000455003 AGAATCTGGACACCCAGTTTG pLKO_005 2137 CDS 100% 10.800 7.560 N PARVG n/a
3 TRCN0000122946 GCTCATCCTACACCACCTATT pLKO.1 1667 CDS 100% 10.800 7.560 N PARVG n/a
4 TRCN0000122948 CACTGAATACAGCACAGACAA pLKO.1 1991 CDS 100% 4.950 3.465 N PARVG n/a
5 TRCN0000122945 GTCATCTTACTCTTGCTGATT pLKO.1 2166 CDS 100% 4.950 3.465 N PARVG n/a
6 TRCN0000122947 GAAGGCTTCTTCCTGCACTTA pLKO.1 2196 CDS 100% 4.950 2.970 N PARVG n/a
7 TRCN0000122944 CCTCCCACAGTCCCGCTGTTT pLKO.1 2507 3UTR 100% 0.000 0.000 N PARVG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08832 pDONR223 100% 91.6% 87.3% None (many diffs) n/a
2 ccsbBroad304_08832 pLX_304 0% 91.6% 87.3% V5 (many diffs) n/a
3 TRCN0000470993 TTCCAATAACGCTAAGACGACGGG pLX_317 42% 91.6% 87.3% V5 (many diffs) n/a
Download CSV