Transcript: Human XM_017029011.2

PREDICTED: Homo sapiens DNA polymerase delta interacting protein 3 (POLDIP3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLDIP3 (84271)
Length:
866
CDS:
62..718

Additional Resources:

NCBI RefSeq record:
XM_017029011.2
NBCI Gene record:
POLDIP3 (84271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312682 TTGCAGAAAGATGCCCGATTT pLKO_005 296 CDS 100% 10.800 15.120 N POLDIP3 n/a
2 TRCN0000370586 CCAGGCCAAACAGAATTTATA pLKO_005 586 CDS 100% 15.000 10.500 N POLDIP3 n/a
3 TRCN0000052929 CCTACTAAACAGATGAAGTTT pLKO.1 644 CDS 100% 5.625 3.938 N POLDIP3 n/a
4 TRCN0000052930 GCCTTCATAAACCCACCCATT pLKO.1 449 CDS 100% 4.050 2.835 N POLDIP3 n/a
5 TRCN0000312683 ATGAAGATGATGATGGTATAG pLKO_005 615 CDS 100% 10.800 6.480 N POLDIP3 n/a
6 TRCN0000052931 GCCGGAATGAGAATCAATGTT pLKO.1 554 CDS 100% 5.625 3.375 N POLDIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12800 pDONR223 100% 72.7% 71.8% None (many diffs) n/a
2 ccsbBroad304_12800 pLX_304 0% 72.7% 71.8% V5 (many diffs) n/a
3 TRCN0000491529 ACTGGCAGGTAGTGCTAAAGGATT pLX_317 62.5% 72.7% 71.8% V5 (many diffs) n/a
Download CSV