Transcript: Human XM_017029152.1

PREDICTED: Homo sapiens SFI1 centrin binding protein (SFI1), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFI1 (9814)
Length:
4200
CDS:
528..4064

Additional Resources:

NCBI RefSeq record:
XM_017029152.1
NBCI Gene record:
SFI1 (9814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272363 GACTGTCACTACAGGTATTAC pLKO_005 717 CDS 100% 13.200 18.480 N SFI1 n/a
2 TRCN0000172573 GCGATTACTACGGAAGGTCTT pLKO.1 635 CDS 100% 4.050 5.670 N SFI1 n/a
3 TRCN0000168207 CTGCTGTGCAAATGTATCGAA pLKO.1 1542 CDS 100% 3.000 4.200 N SFI1 n/a
4 TRCN0000172406 CGACAGCTTCTGTATAGGTCT pLKO.1 1833 CDS 100% 2.640 3.696 N SFI1 n/a
5 TRCN0000247869 ACATTAGAGAAGCAAGTATTT pLKO_005 1737 CDS 100% 13.200 9.240 N Sfi1 n/a
6 TRCN0000272401 ACATTAGAGAAGCAAGTATTT pLKO_005 1737 CDS 100% 13.200 9.240 N SFI1 n/a
7 TRCN0000272362 CTTTCAAGCAAGTACTCATTA pLKO_005 2303 CDS 100% 13.200 9.240 N SFI1 n/a
8 TRCN0000272306 GGAGTTTAGGCAACGGATTAT pLKO_005 917 CDS 100% 13.200 9.240 N SFI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15681 pDONR223 0% 23.5% 21.6% None (many diffs) n/a
2 ccsbBroad304_15681 pLX_304 0% 23.5% 21.6% V5 (many diffs) n/a
Download CSV