Transcript: Human XM_017029191.1

PREDICTED: Homo sapiens HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 (HUWE1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HUWE1 (10075)
Length:
17042
CDS:
3018..16523

Additional Resources:

NCBI RefSeq record:
XM_017029191.1
NBCI Gene record:
HUWE1 (10075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344528 CCTAGGCTGCAGGACTAATAT pLKO_005 13277 CDS 100% 15.000 21.000 N HUWE1 n/a
2 TRCN0000092554 CCGCACTGTGTTAAACCAGAT pLKO.1 15284 CDS 100% 4.050 5.670 N Huwe1 n/a
3 TRCN0000327552 CCGCACTGTGTTAAACCAGAT pLKO_005 15284 CDS 100% 4.050 5.670 N Huwe1 n/a
4 TRCN0000344529 TTTGATGTCAAGCGCAAATAT pLKO_005 15378 CDS 100% 15.000 10.500 N HUWE1 n/a
5 TRCN0000344530 GCTAACTCGGCTACAACATTT pLKO_005 3605 CDS 100% 13.200 9.240 N HUWE1 n/a
6 TRCN0000344549 TGCACAGCTAATGATTCAATG pLKO_005 16961 3UTR 100% 10.800 7.560 N HUWE1 n/a
7 TRCN0000347015 TGCACAGCTAATGATTCAATG pLKO_005 16961 3UTR 100% 10.800 7.560 N Huwe1 n/a
8 TRCN0000073304 CCACACTTTCACAGATACTAT pLKO.1 7706 CDS 100% 5.625 3.938 N HUWE1 n/a
9 TRCN0000092555 CCACAAATATGCCATGATGTT pLKO.1 8762 CDS 100% 4.950 3.465 N Huwe1 n/a
10 TRCN0000327613 CCACAAATATGCCATGATGTT pLKO_005 8762 CDS 100% 4.950 3.465 N Huwe1 n/a
11 TRCN0000073306 CGACGAGAACTAGCACAGAAT pLKO.1 12525 CDS 100% 4.950 3.465 N HUWE1 n/a
12 TRCN0000332987 CGACGAGAACTAGCACAGAAT pLKO_005 12525 CDS 100% 4.950 3.465 N HUWE1 n/a
13 TRCN0000073307 GCTACACAAGATGGAGTCAAA pLKO.1 13211 CDS 100% 4.950 3.465 N HUWE1 n/a
14 TRCN0000073305 GCTCCCACTATAACCTCACTT pLKO.1 11880 CDS 100% 4.950 3.465 N HUWE1 n/a
15 TRCN0000073303 GCGTCTGTGTTGTGGAGGTTT pLKO.1 16995 3UTR 100% 4.950 2.970 N HUWE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.