Transcript: Human XM_017029226.2

PREDICTED: Homo sapiens ecto-NOX disulfide-thiol exchanger 2 (ENOX2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENOX2 (10495)
Length:
3851
CDS:
605..2437

Additional Resources:

NCBI RefSeq record:
XM_017029226.2
NBCI Gene record:
ENOX2 (10495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233162 CAACCGTCGTAGCGCCAATAA pLKO_005 1447 CDS 100% 13.200 18.480 N ENOX2 n/a
2 TRCN0000233163 TGAACAGCAGTCCTATCAAAT pLKO_005 2175 CDS 100% 13.200 18.480 N ENOX2 n/a
3 TRCN0000233160 ATAGGCTATGCAGCCGATAAC pLKO_005 641 CDS 100% 10.800 15.120 N ENOX2 n/a
4 TRCN0000062022 CGATAACAGTAGAACTCTGAA pLKO.1 655 CDS 100% 4.950 6.930 N ENOX2 n/a
5 TRCN0000062021 CCTATCAAATCTGAACGTGAA pLKO.1 2186 CDS 100% 4.050 5.670 N ENOX2 n/a
6 TRCN0000062019 CGCCAATAACTTCTACTCCAT pLKO.1 1459 CDS 100% 2.640 3.696 N ENOX2 n/a
7 TRCN0000062018 CGCAACATTCATAATGATGAA pLKO.1 1712 CDS 100% 0.495 0.396 N ENOX2 n/a
8 TRCN0000233161 TCCAGATATGCCAGTAGTAAA pLKO_005 877 CDS 100% 13.200 9.240 N ENOX2 n/a
9 TRCN0000062020 GCCACAGCAATGAATAATCTT pLKO.1 725 CDS 100% 5.625 3.938 N ENOX2 n/a
10 TRCN0000127371 GCTGAGGAAATTCGCAACATT pLKO.1 1700 CDS 100% 5.625 3.938 N Enox2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11507 pDONR223 100% 51.9% 51.9% None 1_873del;1215_1220delAGCCTT n/a
2 ccsbBroad304_11507 pLX_304 0% 51.9% 51.9% V5 1_873del;1215_1220delAGCCTT n/a
3 TRCN0000465311 GCCAACATGTGCCCTCTAACCCGT pLX_317 22.5% 51.9% 51.9% V5 1_873del;1215_1220delAGCCTT n/a
Download CSV