Transcript: Human XM_017029264.1

PREDICTED: Homo sapiens SPANX family member N3 (SPANXN3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPANXN3 (139067)
Length:
710
CDS:
208..630

Additional Resources:

NCBI RefSeq record:
XM_017029264.1
NBCI Gene record:
SPANXN3 (139067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245762 TACCTCAGGAAGGGTAAGAAA pLKO_005 370 CDS 100% 0.000 0.000 N SPANXN3 n/a
2 TRCN0000167517 GATGGCGATGATTACAATAAA pLKO.1 671 3UTR 100% 15.000 10.500 N SPANXN3 n/a
3 TRCN0000257457 AGGACGAAGGCGTAGACTTAT pLKO_005 458 CDS 100% 13.200 9.240 N SPANXN3 n/a
4 TRCN0000245763 GAATGAACAGTCCCAAGAGAA pLKO_005 411 CDS 100% 4.950 3.465 N SPANXN3 n/a
5 TRCN0000245764 GATGAAGACCTAGGCCCATGT pLKO_005 499 CDS 100% 4.050 2.835 N SPANXN3 n/a
6 TRCN0000245761 GACCTTCAAAGGAGGACAAAG pLKO_005 524 CDS 100% 10.800 6.480 N SPANXN3 n/a
7 TRCN0000172859 GAGGATGAAGACCTAGGCTTA pLKO.1 574 CDS 100% 4.050 2.430 N SPANXN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09577 pDONR223 100% 84.9% 81.9% None (many diffs) n/a
2 ccsbBroad304_09577 pLX_304 0% 84.9% 81.9% V5 (many diffs) n/a
3 TRCN0000476506 CGCCTACTTGTCCCTATCCATCTA pLX_317 69.7% 84.9% 81.9% V5 (many diffs) n/a
Download CSV