Transcript: Human XM_017029272.1

PREDICTED: Homo sapiens apolipoprotein O like (APOOL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOOL (139322)
Length:
969
CDS:
62..877

Additional Resources:

NCBI RefSeq record:
XM_017029272.1
NBCI Gene record:
APOOL (139322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141636 CTACCCAGTTCAGTCCGTAAT pLKO.1 517 CDS 100% 10.800 15.120 N APOOL n/a
2 TRCN0000371340 TAATGGATACAGTACAATTTG pLKO_005 330 CDS 100% 13.200 9.240 N APOOL n/a
3 TRCN0000371341 TAGGATCCTCTTCCGAAATAG pLKO_005 663 CDS 100% 13.200 9.240 N APOOL n/a
4 TRCN0000122648 GCTCTGAAGCAAAGACCAAAT pLKO.1 744 CDS 100% 10.800 7.560 N APOOL n/a
5 TRCN0000121779 CCCAGAAGATATAGATATGTA pLKO.1 841 CDS 100% 5.625 3.938 N APOOL n/a
6 TRCN0000141930 CCAACAGAACTCAGCTCTGAA pLKO.1 731 CDS 100% 4.950 3.465 N APOOL n/a
7 TRCN0000142445 GCAAAGAAGAGTCACTCCCTA pLKO.1 621 CDS 100% 2.640 1.848 N APOOL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04926 pDONR223 100% 98.8% 98.8% None 718_726delGGTTTGTTG n/a
2 ccsbBroad304_04926 pLX_304 0% 98.8% 98.8% V5 718_726delGGTTTGTTG n/a
3 TRCN0000475344 TGCACTATGAACCCCTACCACCTT pLX_317 40.2% 98.8% 98.8% V5 718_726delGGTTTGTTG n/a
Download CSV