Transcript: Human XM_017029407.2

PREDICTED: Homo sapiens NADPH oxidase 1 (NOX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOX1 (27035)
Length:
2179
CDS:
175..1551

Additional Resources:

NCBI RefSeq record:
XM_017029407.2
NBCI Gene record:
NOX1 (27035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046084 CCGCACACTGAGAAAGCAATT pLKO.1 117 5UTR 100% 10.800 15.120 N NOX1 n/a
2 TRCN0000046087 CCTGTTTAACTTTGACTGCTA pLKO.1 213 CDS 100% 2.640 3.696 N NOX1 n/a
3 TRCN0000046083 GCCTATATGATCTGCCTACAT pLKO.1 169 5UTR 100% 4.950 3.960 N NOX1 n/a
4 TRCN0000428100 GTTCATCCGGAGGAGTTATTT pLKO_005 438 CDS 100% 15.000 10.500 N NOX1 n/a
5 TRCN0000415324 GCAAATGCTGTCACCGATATT pLKO_005 1478 CDS 100% 13.200 9.240 N NOX1 n/a
6 TRCN0000046085 CCAAGGTTGTTATGCACCCAT pLKO.1 749 CDS 100% 2.640 1.848 N NOX1 n/a
7 TRCN0000046086 GAACAGGAGATGGAGGAATTA pLKO.1 1222 CDS 100% 13.200 7.920 N NOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08045 pDONR223 100% 81.1% 81.2% None 0_1ins318;447C>T n/a
2 ccsbBroad304_08045 pLX_304 0% 81.1% 81.2% V5 0_1ins318;447C>T n/a
3 TRCN0000478046 TACACATTGTTGAACGCTATTTTC pLX_317 29.1% 81.1% 81.2% V5 0_1ins318;447C>T n/a
Download CSV