Transcript: Human XM_017029474.1

PREDICTED: Homo sapiens NHS like 2 (NHSL2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NHSL2 (340527)
Length:
13294
CDS:
157..3582

Additional Resources:

NCBI RefSeq record:
XM_017029474.1
NBCI Gene record:
NHSL2 (340527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141269 CCCAAGTCACGGCTATCATTT pLKO.1 2197 CDS 100% 13.200 18.480 N NHSL2 n/a
2 TRCN0000122080 CTGAGGAGTATGCACTAACTT pLKO.1 2579 CDS 100% 5.625 7.875 N NHSL2 n/a
3 TRCN0000141579 CACTTGGTCAAAGGGTGACTT pLKO.1 3065 CDS 100% 4.950 6.930 N NHSL2 n/a
4 TRCN0000144389 CAAGAGTATCTCACTTAGGAA pLKO.1 1572 CDS 100% 3.000 4.200 N NHSL2 n/a
5 TRCN0000140957 CGACGTCACCAATGGAGAAAT pLKO.1 2174 CDS 100% 13.200 9.240 N NHSL2 n/a
6 TRCN0000142777 CTTGCAATGGACCTACAGAAT pLKO.1 1040 CDS 100% 4.950 3.465 N NHSL2 n/a
7 TRCN0000122601 GTTCCTGAGGAGTATGCACTA pLKO.1 2575 CDS 100% 4.050 2.835 N NHSL2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4735 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 11289 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 11289 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13600 pDONR223 100% 62.1% 62.1% None 1_846del;2973_3423delinsT n/a
2 ccsbBroad304_13600 pLX_304 0% 62.1% 62.1% V5 1_846del;2973_3423delinsT n/a
3 TRCN0000480990 GCCCTCGGATTGCCTATTCATACG pLX_317 20.1% 62.1% 62.1% V5 1_846del;2973_3423delinsT n/a
Download CSV