Transcript: Human XM_017029486.1

PREDICTED: Homo sapiens zinc finger protein 81 (ZNF81), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF81 (347344)
Length:
11406
CDS:
427..2412

Additional Resources:

NCBI RefSeq record:
XM_017029486.1
NBCI Gene record:
ZNF81 (347344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107387 TCGCACTACTTTCCTCAATAA pLKO.1 879 CDS 100% 13.200 10.560 N ZNF81 n/a
2 TRCN0000107386 CCTGAACTCAGCCCTCAATAT pLKO.1 1614 CDS 100% 13.200 9.240 N ZNF81 n/a
3 TRCN0000107389 CTGAGAGTTCATAGAGATGAA pLKO.1 1387 CDS 100% 0.495 0.347 N ZNF81 n/a
4 TRCN0000107388 GCAGCAAAGAACCTGGATAAA pLKO.1 1063 CDS 100% 13.200 7.920 N ZNF81 n/a
5 TRCN0000107385 GCCCTCAATATACATCAGAAA pLKO.1 1624 CDS 100% 4.950 2.970 N ZNF81 n/a
6 TRCN0000215374 CTAGAGAGAAACCCTATAAAT pLKO.1 1484 CDS 100% 15.000 7.500 Y AI987944 n/a
7 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1901 CDS 100% 10.800 5.400 Y Gm14308 n/a
8 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1820 CDS 100% 5.625 2.813 Y ZNF625 n/a
9 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 1903 CDS 100% 15.000 7.500 Y LOC66376 n/a
10 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 1903 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
11 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1902 CDS 100% 13.200 6.600 Y Gm14305 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.