Transcript: Human XM_017029518.1

PREDICTED: Homo sapiens arrestin 3 (ARR3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARR3 (407)
Length:
1238
CDS:
1..1212

Additional Resources:

NCBI RefSeq record:
XM_017029518.1
NBCI Gene record:
ARR3 (407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155221 GATTGGTCTGACGTTCCGAAA pLKO.1 243 CDS 100% 4.050 5.670 N ARR3 n/a
2 TRCN0000153560 GCACAATTATTAGACCGGGAA pLKO.1 944 CDS 100% 2.160 3.024 N ARR3 n/a
3 TRCN0000152164 CCTGTATTCACTAGACAAGTA pLKO.1 762 CDS 100% 4.950 3.465 N ARR3 n/a
4 TRCN0000150643 GATGGCAAACTTAAGCATGAA pLKO.1 904 CDS 100% 4.950 3.465 N ARR3 n/a
5 TRCN0000152916 CAAAGTCAGAGTCAACCTGAT pLKO.1 999 CDS 100% 4.050 2.835 N ARR3 n/a
6 TRCN0000153215 GATCACAGATGTTGTCCTGTA pLKO.1 747 CDS 100% 4.050 2.835 N ARR3 n/a
7 TRCN0000416583 TTTCGCTATGGCCGTGATGAC pLKO_005 214 CDS 100% 4.050 2.835 N Arr3 n/a
8 TRCN0000153656 CGGAAAGTACAATTTGCACCA pLKO.1 541 CDS 100% 2.160 1.512 N ARR3 n/a
9 TRCN0000155477 GACAGTCTCCAAGAGAGACTA pLKO.1 504 CDS 100% 0.495 0.347 N ARR3 n/a
10 TRCN0000152845 GACATAGTCATCGAGGAGTTT pLKO.1 1129 CDS 100% 4.950 2.475 Y ARR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13815 pDONR223 100% 88.9% 88.5% None (many diffs) n/a
2 ccsbBroad304_13815 pLX_304 0% 88.9% 88.5% V5 (many diffs) n/a
3 TRCN0000479490 AACCCCACGGACCGCCCTGATTCG pLX_317 36.1% 88.9% 88.5% V5 (many diffs) n/a
Download CSV