Transcript: Human XM_017029680.1

PREDICTED: Homo sapiens collectrin, amino acid transport regulator (CLTRN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLTRN (57393)
Length:
1446
CDS:
281..793

Additional Resources:

NCBI RefSeq record:
XM_017029680.1
NBCI Gene record:
CLTRN (57393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118564 ACGCTGAAGATAAGTGTGAAA pLKO.1 666 CDS 100% 4.950 6.930 N CLTRN n/a
2 TRCN0000421897 CATGAAGGGAGGGCATATTAA pLKO_005 730 CDS 100% 15.000 12.000 N CLTRN n/a
3 TRCN0000118562 CCACTGAAATCATAAGCTATT pLKO.1 961 3UTR 100% 10.800 8.640 N CLTRN n/a
4 TRCN0000118566 TGTGCCCATCTGGATTATTAT pLKO.1 541 CDS 100% 15.000 10.500 N CLTRN n/a
5 TRCN0000420562 GTAACCCAGAGGGTATCATTC pLKO_005 353 CDS 100% 10.800 7.560 N CLTRN n/a
6 TRCN0000118565 CTGGCAACGTAGAAGAAAGAA pLKO.1 622 CDS 100% 5.625 3.938 N CLTRN n/a
7 TRCN0000419425 ATACCAAGAGCAGATCATATA pLKO_005 861 3UTR 100% 13.200 7.920 N CLTRN n/a
8 TRCN0000118563 CAATGAAGAATACCTCTTCAA pLKO.1 256 5UTR 100% 0.495 0.297 N CLTRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14230 pDONR223 100% 75.9% 76.1% None 0_1ins156;507_510delTCTC n/a
2 ccsbBroad304_14230 pLX_304 0% 75.9% 76.1% V5 (not translated due to frame shift) 0_1ins156;507_510delTCTC n/a
3 TRCN0000472446 AGAGCAACGATACTTGAGCCGTAC pLX_317 75.3% 75.9% 76.1% V5 (not translated due to frame shift) 0_1ins156;507_510delTCTC n/a
Download CSV